Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 229305765 229309915 enh50234

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 229309058 rs146018504 AAGTCTCTTATTTAAGGGGCCAG A 1008839

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results