EnhancerDB
  1. Home
  2. TFBS
  3. POU2F2[chr1:230890081-230890094]
Chromosome characteristics of POU2F2[chr1:230890081-230890094]
Back to top
Enhancers possibly regulated by POU2F2[chr1:230890081-230890094]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 230883525 230890435 enh67310
Prostate (PC-3) Liver (HepG2) Thyroid Embryonic Stem Cell Line (H1-hESC) Lung (PC-9) Neural Stem Cells (H9)
SNP sites on POU2F2[chr1:230890081-230890094]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 230890088 rs144461206 A ATATATTAATATGTATTAATGAT 1019725
chr1 230890088 rs28359592 A ATATATTAATATGTATTAATGAT 1019726
Genes possibly regulated by POU2F2[chr1:230890081-230890094]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by POU2F2[chr1:230890081-230890094]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results