Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 231745021 231752255 enh988

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 231747276 rs578231069 GGCAGAACCTGTATTTTATTTGGGT G 1024274

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results