Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 240512184 240518517 enh27665

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 240518491 rs566790062 G GGAGGTAATAAGTCTACTTT 1072010
chr1 240518496 rs147812363 T C 1072011

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results