Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 1046865 1057035 enh57572

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 1051776 rs138234754 TCCCCTGGCACCTGGGAAGCTGGGC T 1790797
chr11 1051780 rs534779475 CT C 1790798

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results