Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 2033965 2038835 enh92277

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 2038467 rs201858505 AGGCCCTGGAGGGACAGCCCTGGAGGGAC A 1798882
chr11 2038467 rs376942468 AGGCCCTGGAGGGACAGCCCTGGAGGGAC A 1798883

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results