Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 2275525 2280875 enh13695

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 2280658 rs149521996 TCATTCCCCCAGACAACCTTCA T 1801209
chr11 2280658 rs3214126 TCATTCCCCCAGACAACCTTCA T 1801210

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results