EnhancerDB
  1. Home
  2. TFBS
  3. MAZ[chr11:2536624-2536630]
Chromosome characteristics of MAZ[chr11:2536624-2536630]
Back to top
Enhancers possibly regulated by MAZ[chr11:2536624-2536630]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 2527525 2537095 enh64409
Stomach Heart
SNP sites on MAZ[chr11:2536624-2536630]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 2536628 rs140146748 AGGGCGGAGCCCCTGGCCCAG A 1803519
chr11 2536628 rs141698284 AGGGCGGAGCCCCTGGCCCAG A 1803520
chr11 2536628 rs762959979 AGGGCGGAGCCCCTGGCCCAG A 1803521
chr11 2536628 rs763728703 AGGGCGGAGCCCCTGGCCCAG A 1803522
Genes possibly regulated by MAZ[chr11:2536624-2536630]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by MAZ[chr11:2536624-2536630]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results