EnhancerDB
  1. Home
  2. TFBS
  3. TFAP2C[chr11:2932581-2932596]
Chromosome characteristics of TFAP2C[chr11:2932581-2932596]
Back to top
Enhancers possibly regulated by TFAP2C[chr11:2932581-2932596]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 2931061 2936695 enh13706
Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Large Intestine Esophagus Astrocyte Lung Lung (A549) Stomach Muscle (A673) Placenta Colon (HCT116) Breast Thyroid Lung (PC-9) Pancreas Pancreas (Panc1) Epithelial (MCF-7)
SNP sites on TFAP2C[chr11:2932581-2932596]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 2932581 rs530512762 T TGTGGTGATTTGGAGGATCAGGCAGGC 1807457
Genes possibly regulated by TFAP2C[chr11:2932581-2932596]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TFAP2C[chr11:2932581-2932596]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results