Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 3092385 3104875 enh43479

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 3103904 rs547513977 A AAGAATAATGGCCTCCAGTTCCATC 1808677
chr11 3103905 rs576451308 C T 1808678

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results