| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr11 | 6245245 | 6253495 | enh1620 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr11 | 6253390 | rs531246409 | C | CCATTATACTTAATGCACTACTATTTCAACA | 1819221 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|---|---|---|---|---|---|---|---|---|---|---|
| chr11 | 6232565 | 6255941 | - | FAM160A2 | ENSG00000051009.6 | 6255941 | 0.67 | 1.0 | 2546 | 10510 | |
| chr11 | 6255995 | 6265659 | + | CNGA4 | ENSG00000132259.8 | 6255995 | 0.92 | 1.0 | 2600 | 10511 |
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|