Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 6245245 6253495 enh1620

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 6253390 rs531246409 C CCATTATACTTAATGCACTACTATTTCAACA 1819221

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr11 6232565 6255941 - FAM160A2 ENSG00000051009.6 6255941 0.67 1.0 2546 10510
chr11 6255995 6265659 + CNGA4 ENSG00000132259.8 6255995 0.92 1.0 2600 10511


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results