Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 7011325 7016515 enh28570

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 7012013 rs141268673 AGGGGACTTTGAAAAAGAAG A 1822485
chr11 7012013 rs371932788 AGGGGACTTTGAAAAAGAAG A 1822486

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results