Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 8623365 8629735 enh28574

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 8627206 rs11268653 TCTCAAAACAAACAAACACAC T 1829195
chr11 8627206 rs72207637 TCTCAAAACAAACAAACACAC T 1829196
chr11 8627224 rs61875898 C A 1829197

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results