EnhancerDB
  1. Home
  2. TFBS
  3. YY1[chr11:10306168-10306172]
Chromosome characteristics of YY1[chr11:10306168-10306172]
Back to top
Enhancers possibly regulated by YY1[chr11:10306168-10306172]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 10301705 10312675 enh50706
Liver (HepG2) Brain (SK-N-MC) Large Intestine Esophagus Stomach Lung (PC-9) Epithelial (MCF-7)
SNP sites on YY1[chr11:10306168-10306172]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 10306170 rs370199442 ATTACCCAGGCTGGAGTTTGTTCCG A 1839641
chr11 10306170 rs377569624 ATTACCCAGGCTGGAGTTTGTTCCG A 1839642
chr11 10306170 rs577482047 ATTACCCAGGCTGGAGTTTGTTCCG A 1839643
Genes possibly regulated by YY1[chr11:10306168-10306172]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by YY1[chr11:10306168-10306172]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results