Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 10944685 10957898 enh13765

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 10953606 rs199940839 AAGGAGGTGGTGGTTGGGAGAAAGAGG A 1844832
chr11 10953620 rs558071737 T G 1844833

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results