Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 12217885 12225194 enh13778

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 12222292 rs537837340 GTTTAGCCAAGAGAATCAGAAACTGTA G 1855095

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results