Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 20503590 20507796 enh58335

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 20504358 rs36218371 ATGGAAAGACAAGTCAAGTCAAAAATT A 1896571
chr11 20504358 rs547207517 ATGGAAAGACAAGTCAAGTCAAAAATT A 1896572

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results