Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 20629788 20633938 enh67721

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 20631813 rs561309614 GGCTCCGGGCGCTGGGAAGCAT G 1896927

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results