EnhancerDB
  1. Home
  2. TFBS
  3. RXRA[chr11:63839501-63839518]
Chromosome characteristics of RXRA[chr11:63839501-63839518]
Back to top
Enhancers possibly regulated by RXRA[chr11:63839501-63839518]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 63829799 63865183 enh28836
Bone Marrow (K562) Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Brain (SK-N-MC) Prostate (RWPE1) Lung (PC-9) Esophagus Astrocyte Brain (SK-N-SH) Bone (Osteoblast) Stomach Muscle (A673) Thyroid Muscle (Myoblast) Pancreas Pancreas (Panc1) Muscle (Myotube) Thymus Epithelial (MCF-7)
SNP sites on RXRA[chr11:63839501-63839518]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 63839506 rs9783361 C T 2037728
chr11 63839511 rs183559194 C T 2037729
chr11 63839512 rs571677740 G A 2037730
chr11 63839514 rs560578143 GCACTAAATCCTCCCGGCAGACAA G 2037731
Genes possibly regulated by RXRA[chr11:63839501-63839518]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by RXRA[chr11:63839501-63839518]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results