Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 64170785 64179515 enh13989

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 64177331 rs560874933 TTCCTCTCCATCCTGGCCTACGA T 2040212

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results