Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 65691605 65703755 enh47496

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 65694106 rs576549999 G GTGTATATATATGTACACACATATATATA 2049736
chr11 65694110 rs184701829 A G 2049737

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results