EnhancerDB
  1. Home
  2. TFBS
  3. TFAP2C[chr11:68764265-68764277]
Chromosome characteristics of TFAP2C[chr11:68764265-68764277]
Back to top
Enhancers possibly regulated by TFAP2C[chr11:68764265-68764277]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 68763322 68771655 enh14029
Cervix (HeLa-S3) Brain (SK-N-SH) Brain (SK-N-MC) Prostate (RWPE1) Esophagus Astrocyte Bone (Osteoblast) Placenta Colon (HCT116) Pancreas Muscle (Myotube) Uterus Heart
SNP sites on TFAP2C[chr11:68764265-68764277]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 68764268 rs144474933 CCCCCAGGCTCAGAGGAGCCTGT C 2068757
chr11 68764268 rs373286980 CCCCCAGGCTCAGAGGAGCCTGT C 2068758
chr11 68764268 rs747152158 CCCCCAGGCTCAGAGGAGCCTGT C 2068759
chr11 68764268 rs757328011 CCCCCAGGCTCAGAGGAGCCTGT C 2068760
chr11 68764268 rs777951180 CCCCCAGGCTCAGAGGAGCCTGT C 2068761
Genes possibly regulated by TFAP2C[chr11:68764265-68764277]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TFAP2C[chr11:68764265-68764277]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results