| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr11 | 69411005 | 69421035 | enh67819 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr11 | 69415877 | rs541471928 | C | CTTCAGACCGTCCCTCCCTGAGT | 2075916 | |
| chr11 | 69415880 | rs567297997 | C | CTCTTAGGAACAGGACATGTGCTCTGGCTTTTG | 2075917 | |
| chr11 | 69415882 | rs533411057 | A | AGGAGTCGCCATTGCTTGGGAAGCCCC | 2075918 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|