Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 69411005 69421035 enh67819

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 69415877 rs541471928 C CTTCAGACCGTCCCTCCCTGAGT 2075916
chr11 69415880 rs567297997 C CTCTTAGGAACAGGACATGTGCTCTGGCTTTTG 2075917
chr11 69415882 rs533411057 A AGGAGTCGCCATTGCTTGGGAAGCCCC 2075918

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results