Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 70375577 70382824 enh28867

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 70382084 rs537523147 GCTGGGCCTGAAGCCAGACCAGCCCTA G 2083794

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results