EnhancerDB
  1. Home
  2. TFBS
  3. HOXA5[chr11:73733651-73733659]
Chromosome characteristics of HOXA5[chr11:73733651-73733659]
Back to top
Enhancers possibly regulated by HOXA5[chr11:73733651-73733659]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 73727445 73739035 enh1882
Prostate (PC-3) Liver (HepG2) Large Intestine Esophagus Astrocyte Bone (Osteoblast) Blood (GM12878) Placenta Blood (Karpas-422) Lung (PC-9) Blood (T-cell) Stomach
SNP sites on HOXA5[chr11:73733651-73733659]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 73733656 rs561020656 ACTGCCGTTCTCATCGTCAACCTCTCTCCTCCC A 2103036
Genes possibly regulated by HOXA5[chr11:73733651-73733659]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by HOXA5[chr11:73733651-73733659]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results