Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 74213285 74220175 enh14084

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 74218494 rs530977463 CACAGATATCATCTAGGTCCCTGCCTACCCTGA C 2105024

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results