Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 74812605 74818935 enh28887

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 74816318 rs574822863 CGTCTCAAAAATAATAATAATAAATCGT C 2108183

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results