Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 74970265 74975075 enh107514

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 74972113 rs181873855 T C,G 2108977
chr11 74972117 rs113887473 CCAATATCAGGGTCACGACCCATCCCCA C 2108978

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results