Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 112790774 112804732 enh43614

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 112793354 rs549885707 G GTATGAATGCAACTAAGGTATGAATGCAACTAA 2269904
chr11 112793359 rs117845971 T C 2269905

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results