Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 113532125 113543075 enh14287

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 113537800 rs560546847 AATACAAATAATTTCAAAATAGT A 2273496

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results