| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr11 | 114097465 | 114106679 | enh62211 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr11 | 114103336 | rs572563064 | G | GGCTGGGCTAGGCTAGGCTTGCTCTGCAGA | 2277113 | |
| chr11 | 114103336 | rs59843352 | G | GGCTGGGCTAGGCTAGGCTTGCTCTGCAGA | 2277114 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|