Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 114097465 114106679 enh62211

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 114103336 rs572563064 G GGCTGGGCTAGGCTAGGCTTGCTCTGCAGA 2277113
chr11 114103336 rs59843352 G GGCTGGGCTAGGCTAGGCTTGCTCTGCAGA 2277114

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results