Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 114208850 114227154 enh14290

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 114216685 rs555884929 T TGAAAACTGCTGTGTATTGGTG 2278055

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results