Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 119686678 119690828 enh67952

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 119687165 rs150585677 TCCTTCTAAAAGCTTCATTATTAGG T 2307301
chr11 119687165 rs371859453 TCCTTCTAAAAGCTTCATTATTAGG T 2307302

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results