Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 121521718 121535222 enh29202

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 121532983 rs11272176 T TCAGAGCACAAAGCAGTTTC 2318801
chr11 121532983 rs142192979 T TCAGAGCACAAAGCAGTTTC 2318802

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results