Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 122056511 rs11269680 A AACATTGTACCTATATGAAATAAGAACTTGACTT 2322233

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr11 122017231 122017252 - hsa-let-7a-2-3p MIMAT0010195 122051339 0.478075 0.389974 5170 279
chr11 122022948 122022969 - hsa-miR-100-3p MIMAT0004512 122051339 0.747315 0.749234 5170 281