EnhancerDB
  1. Home
  2. TFBS
  3. MYB[chr11:122056509-122056512]
Chromosome characteristics of MYB[chr11:122056509-122056512]
Back to top
Enhancers possibly regulated by MYB[chr11:122056509-122056512]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 122055165 122083555 enh14335
Prostate (PC-3) Kidney Cervix (HeLa-S3) Brain (SK-N-SH) Prostate (RWPE1) Ovary Esophagus Liver Bone (Osteoblast) Muscle (A673) Placenta Colon (HCT116) Thyroid Lung (PC-9) Muscle (Myoblast) Pancreas (Panc1) Muscle (Myotube) Uterus Heart
SNP sites on MYB[chr11:122056509-122056512]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 122056511 rs11269680 A AACATTGTACCTATATGAAATAAGAACTTGACTT 2322233
Genes possibly regulated by MYB[chr11:122056509-122056512]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by MYB[chr11:122056509-122056512]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr11 122017231 122017252 - hsa-let-7a-2-3p MIMAT0010195 122051339 0.478075 0.389974 5170 279
chr11 122022948 122022969 - hsa-miR-100-3p MIMAT0004512 122051339 0.747315 0.749234 5170 281
Expression level of miRNAs
Back to top