Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 123842576 123846892 enh29220

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 123843193 rs527336967 A ATATCTATATCTATATCTATATCTG 2334780

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results