Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 124349413 124354996 enh29222

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 124352951 rs538165377 TATGTATGTATCATACATACTTTA T 2336973

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results