Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 124591265 124604395 enh2080

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 124595252 rs145406400 A ACTATACTGTATGGATTTTCTC 2337441
chr11 124595252 rs57849144 A ACTATACTGTATGGATTTTCTC 2337442
chr11 124595257 rs560868616 G A,T 2337443

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results