Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 126014745 126039693 enh2087

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 126030128 rs553670346 GGGCAGGGGTCTCTTTCAGGCCTGTTGAT G 2344476

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results