Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 129857425 129868975 enh2110

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 129866691 rs147271269 CCATTTAGAACTGTGTGCTTTGTT C 2367539

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results