| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr11 | 129982265 | 129990518 | enh60341 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr11 | 129982315 | rs188033258 | C | G | 2368718 | |
| chr11 | 129982316 | rs181201029 | T | C | 2368719 | |
| chr11 | 129982321 | rs528541946 | A | ACTAAGGTGACAGGACACAGTACTTATTAAGTTGTTGGGT | 2368720 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|