Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 131288905 131302575 enh14418

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 131301906 rs545137681 ATGAAAACAATATTTAATGAG A 2377692

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results