Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 131732056 131741215 enh29285

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 131732259 rs568828 G T 2379937
chr11 131732263 rs572107541 CCTGAGGAAGGCTTCAACAGAA C 2379938

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results