Chrom Start End Enhancer ID Tissues that enhancer appears More
chr8 10280345 10284915 enh94723

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr8 10284485 rs150708321 G GGGCCTCAAGATCCTCGATC 10275346
chr8 10284485 rs56253110 G GGGCCTCAAGATCCTCGATC 10275347

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results