Chrom Start End Enhancer ID Tissues that enhancer appears More
chr8 10706025 10710275 enh49368

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr8 10709620 rs374321712 AGGAAGGGTCAGTGCGAGGAAG A 10278241
chr8 10709620 rs558022798 AGGAAGGGTCAGTGCGAGGAAG A 10278242

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results