Chrom Start End Enhancer ID Tissues that enhancer appears More
chr8 123882945 123887514 enh73487

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr8 123885596 rs372141201 ACCCCACGTGCAGAAGTGTCAT A 10729015

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results