Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
---|---|---|---|---|---|
chr8 | 125719905 | 125737395 | enh25280 |
|
Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
---|---|---|---|---|---|---|
chr8 | 125730357 | rs369148908 | ATAACCCACTTTCTCATCAAGCGCTTGTGGGTGACTTATTT | A | 10740788 | |
chr8 | 125730357 | rs572879163 | ATAACCCACTTTCTCATCAAGCGCTTGTGGGTGACTTATTT | A | 10740789 |
Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|
Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|