Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 88946220 88957735 enh44357
chr16 88955496 88955935 vista23528

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 88955695 rs563178400 G GGGAGGAGGGATGGAGCGAT 4669376

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results