Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 902405 909675 enh65000

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 907003 rs555577418 TCCTGCTGGGCACAGCCCAC T 4688400

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results